Arnt 2 Rabbit Polyclonal Antibody

Order Now:

Arnt 2 Polyclonal Antibody

ABP57126-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human Arnt 2 at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of Arnt 2 from Human, Mouse, Rat. This Arnt 2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Arnt 2 at AA range: 40-120

Arnt 2 Polyclonal Antibody

ES8125-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Arnt 2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Arnt 2 Polyclonal Antibody

ES8125-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Arnt 2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Anti-Arnt 2 antibody

STJ91699 200 µl
EUR 197
Description: Rabbit polyclonal to Arnt 2.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

EUR 517
  • Should the Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

EUR 673
  • Should the Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

EUR 527
  • Should the Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates or other biological fluids.

Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

EUR 688
  • Should the Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates or other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

RDR-ARNT-Hu-48Tests 48 Tests
EUR 544

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

RDR-ARNT-Hu-96Tests 96 Tests
EUR 756

Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

RDR-ARNT-Mu-48Tests 48 Tests
EUR 557

Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

RDR-ARNT-Mu-96Tests 96 Tests
EUR 774

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

RD-ARNT-Hu-48Tests 48 Tests
EUR 521

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

RD-ARNT-Hu-96Tests 96 Tests
EUR 723

Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

RD-ARNT-Mu-48Tests 48 Tests
EUR 533

Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

RD-ARNT-Mu-96Tests 96 Tests
EUR 740

HIF1B/ARNT Rabbit pAb

A0972-100ul 100 ul
EUR 308

HIF1B/ARNT Rabbit pAb

A0972-200ul 200 ul
EUR 459

HIF1B/ARNT Rabbit pAb

A0972-20ul 20 ul
EUR 183

HIF1B/ARNT Rabbit pAb

A0972-50ul 50 ul
EUR 223

HIF1B/ARNT Rabbit pAb

A14705-100ul 100 ul
EUR 308

HIF1B/ARNT Rabbit pAb

A14705-200ul 200 ul
EUR 459

HIF1B/ARNT Rabbit pAb

A14705-20ul 20 ul
EUR 183

HIF1B/ARNT Rabbit pAb

A14705-50ul 50 ul
EUR 223

HIF1B/ARNT Rabbit mAb

A19532-100ul 100 ul
EUR 410

HIF1B/ARNT Rabbit mAb

A19532-200ul 200 ul
EUR 571

HIF1B/ARNT Rabbit mAb

A19532-20ul 20 ul
EUR 221

HIF1B/ARNT Rabbit mAb

A19532-50ul 50 ul
EUR 287

HIF1B/ARNT Rabbit pAb

A16990-100ul 100 ul
EUR 308

HIF1B/ARNT Rabbit pAb

A16990-200ul 200 ul
EUR 459

HIF1B/ARNT Rabbit pAb

A16990-20ul 20 ul
EUR 183

HIF1B/ARNT Rabbit pAb

A16990-50ul 50 ul
EUR 223

HIF-1 ?/ARNT Polyclonal Antibody

EA159-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HIF-1 ?/ARNT from Rat/ Mouse/ Human. This antibody is tested and validated for WB, ELISA, IHC

HIF-1 ?/ARNT Polyclonal Antibody

EA159-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HIF-1 ?/ARNT from Rat/ Mouse/ Human. This antibody is tested and validated for WB, ELISA, IHC

HIF-1?/ARNT Polyclonal Antibody

EA167-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HIF-1?/ARNT from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC

HIF-1?/ARNT Polyclonal Antibody

EA167-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HIF-1?/ARNT from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC

ARNT antibody

70R-21450 50 ul
EUR 435
Description: Rabbit polyclonal ARNT antibody

ARNT antibody

70R-31659 100 ug
EUR 327
Description: Rabbit polyclonal ARNT antibody

ARNT Antibody

33731-100ul 100ul
EUR 252

ARNT Antibody

33731-50ul 50ul
EUR 187

ARNT Antibody

32101-100ul 100ul
EUR 252

ARNT antibody

10R-3373 100 ul
EUR 726
Description: Mouse monoclonal ARNT antibody

ARNT antibody

10R-3374 100 ul
EUR 691
Description: Mouse monoclonal ARNT antibody

ARNT antibody

10R-3377 100 ul
EUR 691
Description: Mouse monoclonal ARNT antibody

ARNT Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ARNT. Recognizes ARNT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ARNT Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ARNT. Recognizes ARNT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

ARNT Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against ARNT. Recognizes ARNT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500

ARNT Antibody

DF3136 200ul
EUR 304
Description: ARNT Antibody detects endogenous levels of total ARNT.

ARNT Antibody

DF6154 200ul
EUR 304
Description: ARNT Antibody detects endogenous levels of total ARNT.

ARNT Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ARNT. Recognizes ARNT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

ARNT Antibody

CSB-PA174700-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ARNT. Recognizes ARNT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Arnt antibody

70R-7856 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Arnt antibody

Arnt antibody

70R-7857 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Arnt antibody

ARNT Antibody

ABD3136 100 ug
EUR 438

ARNT Antibody

ABD6154 100 ug
EUR 438

Rabbit Polyclonal Antibody to Human Topoisomerase I (Rabbit Serum)

TG2012-2 250 ul
EUR 380

Anti-Bcl-2 Rabbit Monoclonal Antibody

M00040-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Bcl-2 Antibody. Validated in IF, WB and tested in Human, Mouse.

ARNT Conjugated Antibody

C32101 100ul
EUR 397

ARNT,HIF1B Antibody

abx230594-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Anti-ARNT antibody

STJ116905 100 µl
EUR 277
Description: This gene encodes a protein containing a basic helix-loop-helix domain and two characteristic PAS domains along with a PAC domain. The encoded protein binds to ligand-bound aryl hydrocarbon receptor and aids in the movement of this complex to the nucleus, where it promotes the expression of genes involved in xenobiotic metabolism. This protein is also a co-factor for transcriptional regulation by hypoxia-inducible factor 1. Chromosomal translocation of this locus with the ETV6 (ets variant 6) gene on chromosome 12 have been described in leukemias. Alternative splicing results in multiple transcript variants.

Anti-ARNT antibody

STJ22685 100 µl
EUR 277
Description: This gene encodes a protein containing a basic helix-loop-helix domain and two characteristic PAS domains along with a PAC domain. The encoded protein binds to ligand-bound aryl hydrocarbon receptor and aids in the movement of this complex to the nucleus, where it promotes the expression of genes involved in xenobiotic metabolism. This protein is also a co-factor for transcriptional regulation by hypoxia-inducible factor 1. Chromosomal translocation of this locus with the ETV6 (ets variant 6) gene on chromosome 12 have been described in leukemias. Alternative splicing results in multiple transcript variants.

Arnt/ Rat Arnt ELISA Kit

ELI-07321r 96 Tests
EUR 886

Polyclonal ARNT (aa558-570) Antibody (internal region)

APG01987G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ARNT (aa558-570) (internal region). This antibody is tested and proven to work in the following applications:

Anti-COX-2 Rabbit Monoclonal Antibody, Clone#RM348

M00084-2 100uL
EUR 397
Description: Anti-COX-2 Rabbit Monoclonal Antibody, Clone#RM348 tested in WB, IHC, reactive to Human


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA10337 50 ug
EUR 363
Description: Mouse polyclonal to ARNT

anti- ARNT,HIF1B antibody

FNab00594 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:2000
  • Immunogen: aryl hydrocarbon receptor nuclear translocator
  • Uniprot ID: P27540
  • Gene ID: 405
  • Research Area: Epigenetics, Cardiovascular, Metabolism, Signal Transduction
Description: Antibody raised against ARNT,HIF1B

Anti-ARNT,HIF1B antibody

PAab00594 100 ug
EUR 386

Anti-HIF1B/ARNT antibody

STJ119290 100 µl
EUR 277
Description: This gene encodes a protein containing a basic helix-loop-helix domain and two characteristic PAS domains along with a PAC domain. The encoded protein binds to ligand-bound aryl hydrocarbon receptor and aids in the movement of this complex to the nucleus, where it promotes the expression of genes involved in xenobiotic metabolism. This protein is also a co-factor for transcriptional regulation by hypoxia-inducible factor 1. Chromosomal translocation of this locus with the ETV6 (ets variant 6) gene on chromosome 12 have been described in leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]

Polyclonal ARNT / HIF-1-Beta Antibody (aa528-544)

APG01989G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ARNT / HIF-1-Beta (aa528-544). This antibody is tested and proven to work in the following applications:

Aryl hydrocarbon receptor nuclear translocator (ARNT) polyclonal antibody

ABP-PAB-10487 100 ug Ask for price
    • Product line: Genetic Disease Markers
    • Brand:

Rabbit Anti-Human ARNT monoclonal antibody, clone TU16-36

CABT-L680 100 ul
EUR 777

HIF-1 ?/ARNT Monoclonal Antibody

EM1242-100ul 100ul
EUR 279
Description: A Mouse Monoclonal antibody against HIF-1 ?/ARNT from Mouse. This antibody is tested and validated for WB, ELISA, IHC

HIF-1 ?/ARNT Monoclonal Antibody

EM1242-50ul 50ul
EUR 207
Description: A Mouse Monoclonal antibody against HIF-1 ?/ARNT from Mouse. This antibody is tested and validated for WB, ELISA, IHC

Anti-HIF1 beta/ARNT Antibody

PB9129 100ug/vial
EUR 294

Anti-ARNT (aa558-570) antibody

STJ73329 100 µg
EUR 359

Anti-ARNT (aa69-82) antibody

STJ73330 100 µg
EUR 359

Arnt Blocking Peptide

33R-8649 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Arnt antibody, catalog no. 70R-7857

ARNT Blocking Peptide

DF3136-BP 1mg
EUR 195

ARNT Blocking Peptide

DF6154-BP 1mg
EUR 195

ARNT cloning plasmid

CSB-CL002121HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1251
  • Sequence: atggcggcgactactgccaaccccgaaatgacatcagatgtaccatcactgggtccagccattgcctctggaaactctggacctggaattcaaggtggaggagccattgtccagagggctattaagcggcgaccagggctggattttgatgatgatggagaagggaacagtaaat
  • Show more
Description: A cloning plasmid for the ARNT gene.

Anti-ARNT (3D10)

YF-MA10060 100 ug
EUR 363
Description: Mouse monoclonal to ARNT

Anti-ARNT (1F12)

YF-MA12005 50 ug
EUR 363
Description: Mouse monoclonal to ARNT

Anti-ARNT (1F12)

YF-MA12006 200 ul
EUR 363
Description: Mouse monoclonal to ARNT

Anti-p53 Rabbit Monoclonal Antibody

M00001-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal p53 Antibody. Validated in ICC/IF, WB and tested in Human.

Anti-PTEN Rabbit Monoclonal Antibody

M00006-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal PTEN Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-STAT3 Rabbit Monoclonal Antibody

M00007-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal STAT3 Antibody. Validated in IP, IF, WB and tested in Human.

Anti-Rb Rabbit Monoclonal Antibody

M00039-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Rb Antibody. Validated in IP, IF, WB and tested in Human, Mouse.

Anti-Ras Rabbit Monoclonal Antibody

M00099-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Ras Antibody. Validated in Flow Cytometry, IP, WB and tested in Human, Mouse, Rat.

Anti-ERK1 Rabbit Monoclonal Antibody

M00104-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal ERK1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-p21 Rabbit Monoclonal Antibody

M00145-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal p21 Antibody. Validated in IF, ICC, WB and tested in Human, Mouse, Rat.

Anti-p38 Rabbit Monoclonal Antibody

M00176-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal p38 Antibody. Validated in ChIP, IP, IF, WB and tested in Human, Mouse, Rat.

Anti-Rho Rabbit Monoclonal Antibody

M00207-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Rho Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-GFAP Rabbit Monoclonal Antibody

M00213-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal GFAP Antibody. Validated in IF, IHC, WB and tested in Human, Rat.

Anti-LRRK2 Rabbit Monoclonal Antibody

M00221-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal LRRK2 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat.

Anti-MiTF Rabbit Monoclonal Antibody

M00269-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal MiTF Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PAX6 Rabbit Monoclonal Antibody

M00273-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal PAX6 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-MEK1 Rabbit Monoclonal Antibody

M00292-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal MEK1 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Anti-Survivin Rabbit Monoclonal Antibody

M00379-2 100ug/vial
EUR 397
Description: Anti-Survivin Rabbit Monoclonal Antibody tested for IP, IHC, WB in Mouse, Rat

Anti-Hsp27 Rabbit Monoclonal Antibody

M00676-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Hsp27 Antibody. Validated in Flow Cytometry and tested in Human, Mouse, Rat.

Anti-SOX10 Rabbit Monoclonal Antibody

M00758-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal SOX10 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-PAX8 Rabbit Monoclonal Antibody

M00943-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal PAX8 Antibody. Validated in IF, WB and tested in Human.

Anti-PGP9.5 Rabbit Monoclonal Antibody

M01018-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal PGP9.5 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Anti-Podoplanin Rabbit Monoclonal Antibody

M01124-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Podoplanin Antibody. Validated in WB and tested in Human.

Anti-CD74 Rabbit Monoclonal Antibody

M01340-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD74 Antibody. Validated in IF, WB and tested in Human.

Anti-CD31 Rabbit Monoclonal Antibody

M01513-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD31 Antibody. Validated in WB and tested in Human.

Anti-Actin Rabbit Monoclonal Antibody

M02014-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Actin Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.

Anti-MBP Rabbit Monoclonal Antibody

M30934-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal MBP Antibody. Validated in WB and tested in All species.

Anti-GFP Rabbit Monoclonal Antibody

M30939-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal GFP Antibody. Validated in IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

Rabbit Aryl hydrocarbon receptor nuclear translocator, ARNT ELIS

ELI-07322Ra 96 Tests
EUR 928

Arnt sgRNA CRISPR Lentivector (Rat) (Target 2)

K6870003 1.0 ug DNA
EUR 154

ARNT sgRNA CRISPR Lentivector (Human) (Target 2)

K0125503 1.0 ug DNA
EUR 154

Arnt sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3968803 1.0 ug DNA
EUR 154

Cyclooxygenase 2 Rabbit Polyclonal Antibody

38024-100ul 100ul
EUR 252

Cyclooxygenase 2 Rabbit Polyclonal Antibody

38024-50ul 50ul
EUR 187

IGFBP-2 Polyclonal Antibody (Rabbit)

PAAI1 200 µg
EUR 299

Anti-Caspase-8 Rabbit Monoclonal Antibody

M00042-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Caspase-8 Antibody. Validated in ICC/IF, WB and tested in Human.

Anti-ER alpha Rabbit Monoclonal Antibody

M00057-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal ER alpha Antibody. Validated in ChIP, Flow Cytometry, IF, IHC, ICC, WB and tested in Canine, Human, Mouse, Rat.

Anti-Cleaved PARP Rabbit Monoclonal Antibody

M00122-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cleaved PARP Antibody. Validated in Flow Cytometry, IP, IF, ICC, WB and tested in Human.

Anti-CDK1/Cdc2 Rabbit Monoclonal Antibody

M00209-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal CDK1/Cdc2 Antibody. Validated in IP, IF, IHC, WB and tested in Human.

Anti-Androgen Receptor Rabbit Monoclonal Antibody

M00542-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Androgen Receptor Antibody. Validated in IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

Anti-Cyclin B1 Rabbit Monoclonal Antibody

M00745-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cyclin B1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse.

Anti-Liver Arginase Rabbit Monoclonal Antibody

M01106-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Liver Arginase Antibody. Validated in IP, IF, IHC, WB and tested in Human.

Anti-Sumo2/3 Rabbit Monoclonal Antibody

M01282-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Sumo2/3 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-Cytokeratin 18 Rabbit Monoclonal Antibody

M01357-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cytokeratin 18 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

Anti-Cytokeratin 8 Rabbit Monoclonal Antibody

M01421-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cytokeratin 8 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse.

Anti-Cytokeratin 14 Rabbit Monoclonal Antibody

M01432-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cytokeratin 14 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

Anti-CD8 alpha Rabbit Monoclonal Antibody

M02236-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD8 alpha Antibody. Validated in IHC and tested in Human.

Anti-Cytokeratin 7 Rabbit Monoclonal Antibody

M02416-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cytokeratin 7 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-Caspase-6 Rabbit Monoclonal Antibody

M02631-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Caspase-6 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Anti-CD3 epsilon Rabbit Monoclonal Antibody

M02675-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD3 epsilon Antibody. Validated in Flow Cytometry, IP, IHC, WB and tested in Human.

Anti-Histone H4 Rabbit Monoclonal Antibody

M14495-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Histone H4 Antibody. Validated in ChIP, IP, IF, WB and tested in Human, Mouse, Rat.

Anti-Histone H2A Rabbit Monoclonal Antibody

M16777-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Histone H2A Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

Anti-EpCAM/Trop1 Rabbit Monoclonal Antibody

M30950-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal EpCAM/Trop1 Antibody. Validated in WB and tested in Human.

Anti-Cytochrome C Rabbit Monoclonal Antibody

M03529-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cytochrome C Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Polyclonal ARNT (aa69-82) Antibody (internal region, near N-Term)

APG01988G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ARNT (aa69-82) (internal region, near N-Term). This antibody is tested and proven to work in the following applications:

HIF-1 Beta/ARNT Monoclonal Antibody

ABM40245-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A monoclonal antibody for detection of HIF-1 Beta/ARNT from Mouse. This HIF-1 Beta/ARNT antibody is for WB, IHC-P. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

HIF-1 Beta/ARNT Monoclonal Antibody

ABM40245-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A monoclonal antibody for detection of HIF-1 Beta/ARNT from Mouse. This HIF-1 Beta/ARNT antibody is for WB, IHC-P. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

HIF-1 Beta/ARNT Monoclonal Antibody

ABM40245-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A monoclonal antibody for detection of HIF-1 Beta/ARNT from Mouse. This HIF-1 Beta/ARNT antibody is for WB, IHC-P. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

Anti-HIF-1 beta/ARNT antibody

STJ97602 200 µl
EUR 197
Description: Mouse monoclonal to HIF-1 beta/ARNT (4C5).

Anti-HER2 Rabbit Monoclonal Antibody, Clone#RM228

M00010-2 100ul
EUR 375
Description: Anti-HER2 Rabbit Monoclonal Antibody, Clone#RM228 tested in WB, IHC, reactive to Human

Anti-CD44 Rabbit Monoclonal Antibody, Clone#RM264

M00052-2 100uL
EUR 375
Description: Anti-CD44 Rabbit Monoclonal Antibody, Clone#RM264 tested in WB, IHC, reactive to Human

Anti-BRAF Rabbit Monoclonal Antibody, Clone#RM308

M00075-2 100uL
EUR 385
Description: Anti-BRAF Rabbit Monoclonal Antibody, Clone#RM308 tested in WB, IHC, reactive to Human