Order Now: brent@sdlifesciences.com
Arnt 2 Polyclonal Antibody |
ABP57126-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the N-terminal region of human Arnt 2 at AA range: 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of Arnt 2 from Human, Mouse, Rat. This Arnt 2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Arnt 2 at AA range: 40-120 |
Arnt 2 Polyclonal Antibody |
ABP57126-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the N-terminal region of human Arnt 2 at AA range: 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of Arnt 2 from Human, Mouse, Rat. This Arnt 2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Arnt 2 at AA range: 40-120 |
Arnt 2 Polyclonal Antibody |
ABP57126-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the N-terminal region of human Arnt 2 at AA range: 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of Arnt 2 from Human, Mouse, Rat. This Arnt 2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Arnt 2 at AA range: 40-120 |
Anti-Arnt 2 antibody |
STJ91699 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Arnt 2. |
Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit |
DLR-ARNT-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit |
DLR-ARNT-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit |
DLR-ARNT-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates or other biological fluids. |
Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit |
DLR-ARNT-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates or other biological fluids. |
Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit |
RD-ARNT-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit |
RD-ARNT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit |
RD-ARNT-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit |
RD-ARNT-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit |
RDR-ARNT-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit |
RDR-ARNT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit |
RDR-ARNT-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit |
RDR-ARNT-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
HIF-1 ?/ARNT Polyclonal Antibody |
EA159-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HIF-1 ?/ARNT from Rat/ Mouse/ Human. This antibody is tested and validated for WB, ELISA, IHC |
HIF-1 ?/ARNT Polyclonal Antibody |
EA159-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HIF-1 ?/ARNT from Rat/ Mouse/ Human. This antibody is tested and validated for WB, ELISA, IHC |
HIF-1?/ARNT Polyclonal Antibody |
EA167-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HIF-1?/ARNT from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC |
HIF-1?/ARNT Polyclonal Antibody |
EA167-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HIF-1?/ARNT from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC |
HIF1B/ARNT Rabbit pAb |
A0972-100ul |
Abclonal |
100 ul |
EUR 308 |
HIF1B/ARNT Rabbit pAb |
A0972-200ul |
Abclonal |
200 ul |
EUR 459 |
HIF1B/ARNT Rabbit pAb |
A0972-20ul |
Abclonal |
20 ul |
EUR 183 |
HIF1B/ARNT Rabbit pAb |
A0972-50ul |
Abclonal |
50 ul |
EUR 223 |
HIF1B/ARNT Rabbit mAb |
A19532-100ul |
Abclonal |
100 ul |
EUR 410 |
HIF1B/ARNT Rabbit mAb |
A19532-200ul |
Abclonal |
200 ul |
EUR 571 |
HIF1B/ARNT Rabbit mAb |
A19532-20ul |
Abclonal |
20 ul |
EUR 221 |
HIF1B/ARNT Rabbit mAb |
A19532-50ul |
Abclonal |
50 ul |
EUR 287 |
HIF1B/ARNT Rabbit pAb |
A16990-100ul |
Abclonal |
100 ul |
EUR 308 |
HIF1B/ARNT Rabbit pAb |
A16990-200ul |
Abclonal |
200 ul |
EUR 459 |
HIF1B/ARNT Rabbit pAb |
A16990-20ul |
Abclonal |
20 ul |
EUR 183 |
HIF1B/ARNT Rabbit pAb |
A16990-50ul |
Abclonal |
50 ul |
EUR 223 |
HIF1B/ARNT Rabbit pAb |
A14705-100ul |
Abclonal |
100 ul |
EUR 308 |
HIF1B/ARNT Rabbit pAb |
A14705-200ul |
Abclonal |
200 ul |
EUR 459 |
HIF1B/ARNT Rabbit pAb |
A14705-20ul |
Abclonal |
20 ul |
EUR 183 |
HIF1B/ARNT Rabbit pAb |
A14705-50ul |
Abclonal |
50 ul |
EUR 223 |
ARNT antibody |
70R-21450 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal ARNT antibody |
Arnt antibody |
70R-7856 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Arnt antibody |
Arnt antibody |
70R-7857 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Arnt antibody |
ARNT antibody |
70R-31659 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal ARNT antibody |
ARNT Antibody |
33731-100ul |
SAB |
100ul |
EUR 252 |
ARNT Antibody |
33731-50ul |
SAB |
50ul |
EUR 187 |
ARNT Antibody |
32101-100ul |
SAB |
100ul |
EUR 252 |
ARNT antibody |
10R-3373 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal ARNT antibody |
ARNT antibody |
10R-3374 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal ARNT antibody |
ARNT antibody |
10R-3377 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal ARNT antibody |
ARNT Antibody |
DF6154 |
Affbiotech |
200ul |
EUR 304 |
Description: ARNT Antibody detects endogenous levels of total ARNT. |
ARNT Antibody |
DF3136 |
Affbiotech |
200ul |
EUR 304 |
Description: ARNT Antibody detects endogenous levels of total ARNT. |
ARNT Antibody |
1-CSB-PA002121GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against ARNT. Recognizes ARNT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
ARNT Antibody |
1-CSB-PA002907 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against ARNT. Recognizes ARNT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000 |
ARNT Antibody |
CSB-PA174700- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against ARNT. Recognizes ARNT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
ARNT Antibody |
CSB-PA174700-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against ARNT. Recognizes ARNT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
ARNT Antibody |
1-CSB-PA080154 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
|
Description: A polyclonal antibody against ARNT. Recognizes ARNT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500 |
Rabbit Polyclonal Antibody to Human Topoisomerase I (Rabbit Serum) |
TG2012-2 |
TopoGen |
250 ul |
EUR 380 |
Anti-Bcl-2 Rabbit Monoclonal Antibody |
M00040-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Bcl-2 Antibody. Validated in IF, WB and tested in Human, Mouse. |
ARNT Conjugated Antibody |
C32101 |
SAB |
100ul |
EUR 397 |
ARNT,HIF1B Antibody |
abx230594-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Anti-ARNT antibody |
STJ22685 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein containing a basic helix-loop-helix domain and two characteristic PAS domains along with a PAC domain. The encoded protein binds to ligand-bound aryl hydrocarbon receptor and aids in the movement of this complex to the nucleus, where it promotes the expression of genes involved in xenobiotic metabolism. This protein is also a co-factor for transcriptional regulation by hypoxia-inducible factor 1. Chromosomal translocation of this locus with the ETV6 (ets variant 6) gene on chromosome 12 have been described in leukemias. Alternative splicing results in multiple transcript variants. |
Anti-ARNT antibody |
STJ116905 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein containing a basic helix-loop-helix domain and two characteristic PAS domains along with a PAC domain. The encoded protein binds to ligand-bound aryl hydrocarbon receptor and aids in the movement of this complex to the nucleus, where it promotes the expression of genes involved in xenobiotic metabolism. This protein is also a co-factor for transcriptional regulation by hypoxia-inducible factor 1. Chromosomal translocation of this locus with the ETV6 (ets variant 6) gene on chromosome 12 have been described in leukemias. Alternative splicing results in multiple transcript variants. |
Polyclonal ARNT (aa558-570) Antibody (internal region) |
APG01987G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ARNT (aa558-570) (internal region). This antibody is tested and proven to work in the following applications: |
Anti-COX-2 Rabbit Monoclonal Antibody, Clone#RM348 |
M00084-2 |
BosterBio |
100uL |
EUR 397 |
Description: Anti-COX-2 Rabbit Monoclonal Antibody, Clone#RM348 tested in WB, IHC, reactive to Human |
ARNT siRNA |
20-abx900450 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ARNT siRNA |
20-abx908189 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ARNT siRNA |
20-abx908190 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-ARNT |
YF-PA10337 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to ARNT |
anti- ARNT,HIF1B antibody |
FNab00594 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:2000
- IP: 1:500-1:2000
- Immunogen: aryl hydrocarbon receptor nuclear translocator
- Uniprot ID: P27540
- Gene ID: 405
- Research Area: Epigenetics, Cardiovascular, Metabolism, Signal Transduction
|
Description: Antibody raised against ARNT,HIF1B |
Anti-HIF1B/ARNT antibody |
STJ119290 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein containing a basic helix-loop-helix domain and two characteristic PAS domains along with a PAC domain. The encoded protein binds to ligand-bound aryl hydrocarbon receptor and aids in the movement of this complex to the nucleus, where it promotes the expression of genes involved in xenobiotic metabolism. This protein is also a co-factor for transcriptional regulation by hypoxia-inducible factor 1. Chromosomal translocation of this locus with the ETV6 (ets variant 6) gene on chromosome 12 have been described in leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013] |
Polyclonal ARNT / HIF-1-Beta Antibody (aa528-544) |
APG01989G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ARNT / HIF-1-Beta (aa528-544). This antibody is tested and proven to work in the following applications: |
Aryl hydrocarbon receptor nuclear translocator (ARNT) polyclonal antibody |
ABP-PAB-10487 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Genetic Disease Markers
- Brand:
|
Rabbit Anti-Human ARNT monoclonal antibody, clone TU16-36 |
CABT-L680 |
Creative Diagnostics |
100 ul |
EUR 777 |
HIF-1 ?/ARNT Monoclonal Antibody |
EM1242-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Mouse Monoclonal antibody against HIF-1 ?/ARNT from Mouse. This antibody is tested and validated for WB, ELISA, IHC |
HIF-1 ?/ARNT Monoclonal Antibody |
EM1242-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Mouse Monoclonal antibody against HIF-1 ?/ARNT from Mouse. This antibody is tested and validated for WB, ELISA, IHC |
Anti-HIF1 beta/ARNT Antibody |
PB9129 |
BosterBio |
100ug/vial |
EUR 294 |
Arnt Blocking Peptide |
33R-8649 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Arnt antibody, catalog no. 70R-7857 |
ARNT Blocking Peptide |
DF6154-BP |
Affbiotech |
1mg |
EUR 195 |
ARNT Blocking Peptide |
DF3136-BP |
Affbiotech |
1mg |
EUR 195 |
ARNT cloning plasmid |
CSB-CL002121HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1251
- Sequence: atggcggcgactactgccaaccccgaaatgacatcagatgtaccatcactgggtccagccattgcctctggaaactctggacctggaattcaaggtggaggagccattgtccagagggctattaagcggcgaccagggctggattttgatgatgatggagaagggaacagtaaat
- Show more
|
Description: A cloning plasmid for the ARNT gene. |
Anti-ARNT (1F12) |
YF-MA12005 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse monoclonal to ARNT |
Anti-ARNT (1F12) |
YF-MA12006 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to ARNT |
Anti-ARNT (3D10) |
YF-MA10060 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ARNT |
Anti-p53 Rabbit Monoclonal Antibody |
M00001-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal p53 Antibody. Validated in ICC/IF, WB and tested in Human. |
Anti-PTEN Rabbit Monoclonal Antibody |
M00006-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal PTEN Antibody. Validated in IF, WB and tested in Human, Mouse, Rat. |
Anti-STAT3 Rabbit Monoclonal Antibody |
M00007-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal STAT3 Antibody. Validated in IP, IF, WB and tested in Human. |
Anti-Rb Rabbit Monoclonal Antibody |
M00039-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Rb Antibody. Validated in IP, IF, WB and tested in Human, Mouse. |
Anti-Ras Rabbit Monoclonal Antibody |
M00099-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Ras Antibody. Validated in Flow Cytometry, IP, WB and tested in Human, Mouse, Rat. |
Anti-ERK1 Rabbit Monoclonal Antibody |
M00104-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal ERK1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat. |
Anti-p21 Rabbit Monoclonal Antibody |
M00145-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal p21 Antibody. Validated in IF, ICC, WB and tested in Human, Mouse, Rat. |
Anti-p38 Rabbit Monoclonal Antibody |
M00176-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal p38 Antibody. Validated in ChIP, IP, IF, WB and tested in Human, Mouse, Rat. |
Anti-Rho Rabbit Monoclonal Antibody |
M00207-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Rho Antibody. Validated in IF, WB and tested in Human, Mouse, Rat. |
Anti-GFAP Rabbit Monoclonal Antibody |
M00213-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal GFAP Antibody. Validated in IF, IHC, WB and tested in Human, Rat. |
Anti-LRRK2 Rabbit Monoclonal Antibody |
M00221-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal LRRK2 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat. |
Anti-MiTF Rabbit Monoclonal Antibody |
M00269-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal MiTF Antibody. Validated in WB and tested in Human, Mouse, Rat. |
Anti-PAX6 Rabbit Monoclonal Antibody |
M00273-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal PAX6 Antibody. Validated in WB and tested in Human, Mouse, Rat. |
Anti-MEK1 Rabbit Monoclonal Antibody |
M00292-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal MEK1 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat. |
Anti-Survivin Rabbit Monoclonal Antibody |
M00379-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Anti-Survivin Rabbit Monoclonal Antibody tested for IP, IHC, WB in Mouse, Rat |
Anti-Hsp27 Rabbit Monoclonal Antibody |
M00676-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Hsp27 Antibody. Validated in Flow Cytometry and tested in Human, Mouse, Rat. |
Anti-SOX10 Rabbit Monoclonal Antibody |
M00758-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal SOX10 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat. |
Anti-PAX8 Rabbit Monoclonal Antibody |
M00943-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal PAX8 Antibody. Validated in IF, WB and tested in Human. |
Anti-PGP9.5 Rabbit Monoclonal Antibody |
M01018-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal PGP9.5 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat. |
Anti-Podoplanin Rabbit Monoclonal Antibody |
M01124-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Podoplanin Antibody. Validated in WB and tested in Human. |
Anti-CD74 Rabbit Monoclonal Antibody |
M01340-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal CD74 Antibody. Validated in IF, WB and tested in Human. |
Anti-CD31 Rabbit Monoclonal Antibody |
M01513-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal CD31 Antibody. Validated in WB and tested in Human. |
Anti-Actin Rabbit Monoclonal Antibody |
M02014-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Actin Antibody. Validated in IP, WB and tested in Human, Mouse, Rat. |
Anti-MBP Rabbit Monoclonal Antibody |
M30934-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal MBP Antibody. Validated in WB and tested in All species. |
Anti-GFP Rabbit Monoclonal Antibody |
M30939-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal GFP Antibody. Validated in IF, IHC, ICC, WB and tested in Human, Mouse, Rat. |
Rabbit Aryl hydrocarbon receptor nuclear translocator, ARNT ELIS |
ELI-07322Ra |
Lifescience Market |
96 Tests |
EUR 928 |
ARNT sgRNA CRISPR Lentivector (Human) (Target 2) |
K0125503 |
ABM |
1.0 ug DNA |
EUR 154 |
Arnt sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3968803 |
ABM |
1.0 ug DNA |
EUR 154 |
Arnt sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6870003 |
ABM |
1.0 ug DNA |
EUR 154 |
Cyclooxygenase 2 Rabbit Polyclonal Antibody |
38024-100ul |
SAB |
100ul |
EUR 252 |
Cyclooxygenase 2 Rabbit Polyclonal Antibody |
38024-50ul |
SAB |
50ul |
EUR 187 |
IGFBP-2 Polyclonal Antibody (Rabbit) |
PAAI1 |
GroPep |
200 µg |
EUR 299 |
Anti-Caspase-8 Rabbit Monoclonal Antibody |
M00042-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Caspase-8 Antibody. Validated in ICC/IF, WB and tested in Human. |
Anti-ER alpha Rabbit Monoclonal Antibody |
M00057-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal ER alpha Antibody. Validated in ChIP, Flow Cytometry, IF, IHC, ICC, WB and tested in Canine, Human, Mouse, Rat. |
Anti-Cleaved PARP Rabbit Monoclonal Antibody |
M00122-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Cleaved PARP Antibody. Validated in Flow Cytometry, IP, IF, ICC, WB and tested in Human. |
Anti-CDK1/Cdc2 Rabbit Monoclonal Antibody |
M00209-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal CDK1/Cdc2 Antibody. Validated in IP, IF, IHC, WB and tested in Human. |
Anti-Androgen Receptor Rabbit Monoclonal Antibody |
M00542-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Androgen Receptor Antibody. Validated in IF, IHC, ICC, WB and tested in Human, Mouse, Rat. |
Anti-Cyclin B1 Rabbit Monoclonal Antibody |
M00745-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Cyclin B1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse. |
Anti-Liver Arginase Rabbit Monoclonal Antibody |
M01106-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Liver Arginase Antibody. Validated in IP, IF, IHC, WB and tested in Human. |
Anti-Sumo2/3 Rabbit Monoclonal Antibody |
M01282-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Sumo2/3 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat. |
Anti-Cytokeratin 18 Rabbit Monoclonal Antibody |
M01357-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Cytokeratin 18 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat. |
Anti-Cytokeratin 8 Rabbit Monoclonal Antibody |
M01421-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Cytokeratin 8 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse. |
Anti-Cytokeratin 14 Rabbit Monoclonal Antibody |
M01432-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Cytokeratin 14 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat. |
Anti-CD8 alpha Rabbit Monoclonal Antibody |
M02236-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal CD8 alpha Antibody. Validated in IHC and tested in Human. |
Anti-Cytokeratin 7 Rabbit Monoclonal Antibody |
M02416-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Cytokeratin 7 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat. |
Anti-Caspase-6 Rabbit Monoclonal Antibody |
M02631-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Caspase-6 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat. |
Anti-CD3 epsilon Rabbit Monoclonal Antibody |
M02675-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal CD3 epsilon Antibody. Validated in Flow Cytometry, IP, IHC, WB and tested in Human. |
Anti-Histone H4 Rabbit Monoclonal Antibody |
M14495-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Histone H4 Antibody. Validated in ChIP, IP, IF, WB and tested in Human, Mouse, Rat. |
Anti-Histone H2A Rabbit Monoclonal Antibody |
M16777-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Histone H2A Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat. |
Anti-EpCAM/Trop1 Rabbit Monoclonal Antibody |
M30950-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal EpCAM/Trop1 Antibody. Validated in WB and tested in Human. |
Anti-Cytochrome C Rabbit Monoclonal Antibody |
M03529-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Cytochrome C Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat. |
Polyclonal ARNT (aa69-82) Antibody (internal region, near N-Term) |
APG01988G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ARNT (aa69-82) (internal region, near N-Term). This antibody is tested and proven to work in the following applications: |
HIF-1 Beta/ARNT Monoclonal Antibody |
ABM40245-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
Description: A monoclonal antibody for detection of HIF-1 Beta/ARNT from Mouse. This HIF-1 Beta/ARNT antibody is for WB, IHC-P. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein |
HIF-1 Beta/ARNT Monoclonal Antibody |
ABM40245-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
Description: A monoclonal antibody for detection of HIF-1 Beta/ARNT from Mouse. This HIF-1 Beta/ARNT antibody is for WB, IHC-P. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein |
HIF-1 Beta/ARNT Monoclonal Antibody |
ABM40245-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
Description: A monoclonal antibody for detection of HIF-1 Beta/ARNT from Mouse. This HIF-1 Beta/ARNT antibody is for WB, IHC-P. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein |
Anti-HIF-1 beta/ARNT antibody |
STJ97602 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Mouse monoclonal to HIF-1 beta/ARNT (4C5). |
Anti-HER2 Rabbit Monoclonal Antibody, Clone#RM228 |
M00010-2 |
BosterBio |
100ul |
EUR 375 |
Description: Anti-HER2 Rabbit Monoclonal Antibody, Clone#RM228 tested in WB, IHC, reactive to Human |
Anti-CD44 Rabbit Monoclonal Antibody, Clone#RM264 |
M00052-2 |
BosterBio |
100uL |
EUR 375 |
Description: Anti-CD44 Rabbit Monoclonal Antibody, Clone#RM264 tested in WB, IHC, reactive to Human |
Anti-BRAF Rabbit Monoclonal Antibody, Clone#RM308 |
M00075-2 |
BosterBio |
100uL |
EUR 385 |
Description: Anti-BRAF Rabbit Monoclonal Antibody, Clone#RM308 tested in WB, IHC, reactive to Human |