ARHGAP12 Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

ARHGAP12 Antibody

39930-100ul 100ul
EUR 390

ARHGAP12 Antibody

1-CSB-PA070306
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ARHGAP12. Recognizes ARHGAP12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

ARHGAP12 antibody

70R-34960 100 ug
EUR 349
Description: Purified Rabbit polyclonal ARHGAP12 antibody

Anti-ARHGAP12 antibody

STJ91680 200 µl
EUR 197
Description: Rabbit polyclonal to ARHGAP12.

ARHGAP12 siRNA

20-abx907963
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARHGAP12 siRNA

20-abx907964
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ARHGAP12

YF-PA21806 50 ug
EUR 363
Description: Mouse polyclonal to ARHGAP12

ARHGAP12 cloning plasmid

CSB-CL816896HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2400
  • Sequence: ATGAAAATGGCTGACAGAAGTGGGAAGATTATTCCAGGACAAGTGTATATTGAGGTGGAATATGATTATGAATATGAAGCAAAGGACAGAAAGATTGTGATAAAACAAGGGGAGAGGTACATCTTGGTGAAAAAGACCAATGATGACTGGTGGCAAGTCAAGCCAGATGAAAACT
  • Show more
Description: A cloning plasmid for the ARHGAP12 gene.

Mouse ARHGAP12 shRNA Plasmid

20-abx978392
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ARHGAP12 shRNA Plasmid

20-abx964256
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rho GTPase Activating Protein 12 (ARHGAP12) Antibody

abx037200-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Rho GTPase Activating Protein 12 (ARHGAP12) Antibody

20-abx327809
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Arhgap12 ORF Vector (Rat) (pORF)

ORF063582 1.0 ug DNA
EUR 506

ARHGAP12 ORF Vector (Human) (pORF)

ORF012235 1.0 ug DNA
EUR 354

Arhgap12 ORF Vector (Mouse) (pORF)

ORF038921 1.0 ug DNA
EUR 506

Arhgap12 ORF Vector (Mouse) (pORF)

ORF038922 1.0 ug DNA
EUR 506

Arhgap12 sgRNA CRISPR Lentivector set (Mouse)

K4939201 3 x 1.0 ug
EUR 339

Arhgap12 sgRNA CRISPR Lentivector set (Rat)

K6599901 3 x 1.0 ug
EUR 339

ARHGAP12 sgRNA CRISPR Lentivector set (Human)

K0115401 3 x 1.0 ug
EUR 339

Arhgap12 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4939202 1.0 ug DNA
EUR 154

Arhgap12 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4939203 1.0 ug DNA
EUR 154

Arhgap12 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4939204 1.0 ug DNA
EUR 154

Arhgap12 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6599902 1.0 ug DNA
EUR 154

Arhgap12 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6599903 1.0 ug DNA
EUR 154

Arhgap12 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6599904 1.0 ug DNA
EUR 154

ARHGAP12 sgRNA CRISPR Lentivector (Human) (Target 1)

K0115402 1.0 ug DNA
EUR 154

ARHGAP12 sgRNA CRISPR Lentivector (Human) (Target 2)

K0115403 1.0 ug DNA
EUR 154

ARHGAP12 sgRNA CRISPR Lentivector (Human) (Target 3)

K0115404 1.0 ug DNA
EUR 154

ARHGAP12 Protein Vector (Mouse) (pPB-C-His)

PV155682 500 ng
EUR 1065

ARHGAP12 Protein Vector (Mouse) (pPB-N-His)

PV155683 500 ng
EUR 1065

ARHGAP12 Protein Vector (Mouse) (pPM-C-HA)

PV155684 500 ng
EUR 1065

ARHGAP12 Protein Vector (Mouse) (pPM-C-His)

PV155685 500 ng
EUR 1065

ARHGAP12 Protein Vector (Mouse) (pPB-C-His)

PV155686 500 ng
EUR 1065

ARHGAP12 Protein Vector (Mouse) (pPB-N-His)

PV155687 500 ng
EUR 1065

ARHGAP12 Protein Vector (Mouse) (pPM-C-HA)

PV155688 500 ng
EUR 1065

ARHGAP12 Protein Vector (Mouse) (pPM-C-His)

PV155689 500 ng
EUR 1065

ARHGAP12 Protein Vector (Rat) (pPB-C-His)

PV254326 500 ng
EUR 603

ARHGAP12 Protein Vector (Rat) (pPB-N-His)

PV254327 500 ng
EUR 603

ARHGAP12 Protein Vector (Rat) (pPM-C-HA)

PV254328 500 ng
EUR 603

ARHGAP12 Protein Vector (Rat) (pPM-C-His)

PV254329 500 ng
EUR 603

ARHGAP12 Protein Vector (Human) (pPB-His-MBP)

PV323254 500 ng
EUR 481

ARHGAP12 Protein Vector (Human) (pPB-His-GST)

PV323255 500 ng
EUR 481

ARHGAP12 Protein Vector (Human) (pPB-C-His)

PV048937 500 ng
EUR 481

ARHGAP12 Protein Vector (Human) (pPB-N-His)

PV048938 500 ng
EUR 481

ARHGAP12 Protein Vector (Human) (pPM-C-HA)

PV048939 500 ng
EUR 481

ARHGAP12 Protein Vector (Human) (pPM-C-His)

PV048940 500 ng
EUR 481

Arhgap12 3'UTR GFP Stable Cell Line

TU152033 1.0 ml Ask for price

Arhgap12 3'UTR Luciferase Stable Cell Line

TU102033 1.0 ml Ask for price

Arhgap12 3'UTR Luciferase Stable Cell Line

TU200826 1.0 ml Ask for price

Arhgap12 3'UTR GFP Stable Cell Line

TU250826 1.0 ml Ask for price

ARHGAP12 3'UTR GFP Stable Cell Line

TU051057 1.0 ml
EUR 1521

ARHGAP12 3'UTR Luciferase Stable Cell Line

TU001057 1.0 ml
EUR 1521

Mouse Rho GTPase- activating protein 12, Arhgap12 ELISA KIT

ELI-30321m 96 Tests
EUR 865

Human Rho GTPase- activating protein 12, ARHGAP12 ELISA KIT

ELI-35574h 96 Tests
EUR 824

ARHGAP12 Protein Vector (Human) (pPM-N-D-C-HA)

PV323256 500 ng
EUR 481

ARHGAP12 Protein Vector (Human) (pPM-N-D-C-His)

PV323257 500 ng
EUR 481