ARHGAP12 Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

ARHGAP12 Antibody
39930-100ul	SAB	100ul	EUR 390

ARHGAP12 Antibody
1-CSB-PA070306	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ARHGAP12. Recognizes ARHGAP12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

ARHGAP12 antibody
70R-34960	Fitzgerald	100 ug	EUR 349
Description: Purified Rabbit polyclonal ARHGAP12 antibody

Anti-ARHGAP12 antibody
STJ91680	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to ARHGAP12.

ARHGAP12 siRNA
20-abx907963	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ARHGAP12 siRNA
20-abx907964	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-ARHGAP12
YF-PA21806	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to ARHGAP12

ARHGAP12 cloning plasmid
CSB-CL816896HU-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2400 Sequence: ATGAAAATGGCTGACAGAAGTGGGAAGATTATTCCAGGACAAGTGTATATTGAGGTGGAATATGATTATGAATATGAAGCAAAGGACAGAAAGATTGTGATAAAACAAGGGGAGAGGTACATCTTGGTGAAAAAGACCAATGATGACTGGTGGCAAGTCAAGCCAGATGAAAACT Show more
Description: A cloning plasmid for the ARHGAP12 gene.

Mouse ARHGAP12 shRNA Plasmid
20-abx978392	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ARHGAP12 shRNA Plasmid
20-abx964256	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rho GTPase Activating Protein 12 (ARHGAP12) Antibody
abx037200-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Rho GTPase Activating Protein 12 (ARHGAP12) Antibody
20-abx327809	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Arhgap12 ORF Vector (Rat) (pORF)
ORF063582	ABM	1.0 ug DNA	EUR 506

ARHGAP12 ORF Vector (Human) (pORF)
ORF012235	ABM	1.0 ug DNA	EUR 354

Arhgap12 ORF Vector (Mouse) (pORF)
ORF038921	ABM	1.0 ug DNA	EUR 506

Arhgap12 ORF Vector (Mouse) (pORF)
ORF038922	ABM	1.0 ug DNA	EUR 506

Arhgap12 sgRNA CRISPR Lentivector set (Mouse)
K4939201	ABM	3 x 1.0 ug	EUR 339

Arhgap12 sgRNA CRISPR Lentivector set (Rat)
K6599901	ABM	3 x 1.0 ug	EUR 339

ARHGAP12 sgRNA CRISPR Lentivector set (Human)
K0115401	ABM	3 x 1.0 ug	EUR 339

Arhgap12 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4939202	ABM	1.0 ug DNA	EUR 154

Arhgap12 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4939203	ABM	1.0 ug DNA	EUR 154

Arhgap12 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4939204	ABM	1.0 ug DNA	EUR 154

Arhgap12 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6599902	ABM	1.0 ug DNA	EUR 154

Arhgap12 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6599903	ABM	1.0 ug DNA	EUR 154

Arhgap12 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6599904	ABM	1.0 ug DNA	EUR 154

ARHGAP12 sgRNA CRISPR Lentivector (Human) (Target 1)
K0115402	ABM	1.0 ug DNA	EUR 154

ARHGAP12 sgRNA CRISPR Lentivector (Human) (Target 2)
K0115403	ABM	1.0 ug DNA	EUR 154

ARHGAP12 sgRNA CRISPR Lentivector (Human) (Target 3)
K0115404	ABM	1.0 ug DNA	EUR 154

ARHGAP12 Protein Vector (Mouse) (pPB-C-His)
PV155682	ABM	500 ng	EUR 1065

ARHGAP12 Protein Vector (Mouse) (pPB-N-His)
PV155683	ABM	500 ng	EUR 1065

ARHGAP12 Protein Vector (Mouse) (pPM-C-HA)
PV155684	ABM	500 ng	EUR 1065

ARHGAP12 Protein Vector (Mouse) (pPM-C-His)
PV155685	ABM	500 ng	EUR 1065

ARHGAP12 Protein Vector (Mouse) (pPB-C-His)
PV155686	ABM	500 ng	EUR 1065

ARHGAP12 Protein Vector (Mouse) (pPB-N-His)
PV155687	ABM	500 ng	EUR 1065

ARHGAP12 Protein Vector (Mouse) (pPM-C-HA)
PV155688	ABM	500 ng	EUR 1065

ARHGAP12 Protein Vector (Mouse) (pPM-C-His)
PV155689	ABM	500 ng	EUR 1065

ARHGAP12 Protein Vector (Rat) (pPB-C-His)
PV254326	ABM	500 ng	EUR 603

ARHGAP12 Protein Vector (Rat) (pPB-N-His)
PV254327	ABM	500 ng	EUR 603

ARHGAP12 Protein Vector (Rat) (pPM-C-HA)
PV254328	ABM	500 ng	EUR 603

ARHGAP12 Protein Vector (Rat) (pPM-C-His)
PV254329	ABM	500 ng	EUR 603

ARHGAP12 Protein Vector (Human) (pPB-His-MBP)
PV323254	ABM	500 ng	EUR 481

ARHGAP12 Protein Vector (Human) (pPB-His-GST)
PV323255	ABM	500 ng	EUR 481

ARHGAP12 Protein Vector (Human) (pPB-C-His)
PV048937	ABM	500 ng	EUR 481

ARHGAP12 Protein Vector (Human) (pPB-N-His)
PV048938	ABM	500 ng	EUR 481

ARHGAP12 Protein Vector (Human) (pPM-C-HA)
PV048939	ABM	500 ng	EUR 481

ARHGAP12 Protein Vector (Human) (pPM-C-His)
PV048940	ABM	500 ng	EUR 481

Arhgap12 3'UTR GFP Stable Cell Line
TU152033	ABM	1.0 ml	Ask for price

Arhgap12 3'UTR Luciferase Stable Cell Line
TU102033	ABM	1.0 ml	Ask for price

Arhgap12 3'UTR Luciferase Stable Cell Line
TU200826	ABM	1.0 ml	Ask for price

Arhgap12 3'UTR GFP Stable Cell Line
TU250826	ABM	1.0 ml	Ask for price

ARHGAP12 3'UTR GFP Stable Cell Line
TU051057	ABM	1.0 ml	EUR 1521

ARHGAP12 3'UTR Luciferase Stable Cell Line
TU001057	ABM	1.0 ml	EUR 1521

Mouse Rho GTPase- activating protein 12, Arhgap12 ELISA KIT
ELI-30321m	Lifescience Market	96 Tests	EUR 865

Human Rho GTPase- activating protein 12, ARHGAP12 ELISA KIT
ELI-35574h	Lifescience Market	96 Tests	EUR 824

ARHGAP12 Protein Vector (Human) (pPM-N-D-C-HA)
PV323256	ABM	500 ng	EUR 481

ARHGAP12 Protein Vector (Human) (pPM-N-D-C-His)
PV323257	ABM	500 ng	EUR 481