Order Now: brent@sdlifesciences.com
ARHGAP11A Polyclonal Antibody |
ABP57102-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human ARHGAP11A at AA range: 440-520
- Applications tips:
|
Description: A polyclonal antibody for detection of ARHGAP11A from Human. This ARHGAP11A antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ARHGAP11A at AA range: 440-520 |
ARHGAP11A Polyclonal Antibody |
ABP57102-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human ARHGAP11A at AA range: 440-520
- Applications tips:
|
Description: A polyclonal antibody for detection of ARHGAP11A from Human. This ARHGAP11A antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ARHGAP11A at AA range: 440-520 |
ARHGAP11A Polyclonal Antibody |
A65518 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
ARHGAP11A Antibody |
DF4425 |
Affbiotech |
200ul |
EUR 304 |
Description: ARHGAP11A Antibody detects endogenous levels of total ARHGAP11A. |
ARHGAP11A Antibody |
1-CSB-PA750800LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ARHGAP11A. Recognizes ARHGAP11A from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
ARHGAP11A Antibody |
1-CSB-PA080065 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against ARHGAP11A. Recognizes ARHGAP11A from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000 |
ARHGAP11A Antibody |
CSB-PA059167- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against ARHGAP11A. Recognizes ARHGAP11A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
ARHGAP11A Antibody |
CSB-PA059167-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against ARHGAP11A. Recognizes ARHGAP11A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
ARHGAP11A Polyclonal Antibody, HRP Conjugated |
A65519 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
ARHGAP11A Polyclonal Antibody, FITC Conjugated |
A65520 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
ARHGAP11A Polyclonal Antibody, Biotin Conjugated |
A65521 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Anti-ARHGAP11A antibody |
STJ91679 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to ARHGAP11A. |
ARHGAP11A siRNA |
20-abx907960 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ARHGAP11A siRNA |
20-abx907961 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ARHGAP11A Antibody, HRP conjugated |
1-CSB-PA750800LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ARHGAP11A. Recognizes ARHGAP11A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
ARHGAP11A Antibody, FITC conjugated |
1-CSB-PA750800LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ARHGAP11A. Recognizes ARHGAP11A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
ARHGAP11A Antibody, Biotin conjugated |
1-CSB-PA750800LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ARHGAP11A. Recognizes ARHGAP11A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
ARHGAP11A Blocking Peptide |
DF4425-BP |
Affbiotech |
1mg |
EUR 195 |
ARHGAP11A cloning plasmid |
CSB-CL750800HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1506
- Sequence: atgtgggatcagaggctggtgaggttggccctgttgcagcatctgcgggccttctatggtattaaggtgaagggtgtccgtgggcagtgcgatcgcaggagacatgaaacagcagccacggaaatagggggtaaaatatttggagtaccttttaatgcactgccccattctgctg
- Show more
|
Description: A cloning plasmid for the ARHGAP11A gene. |
Human ARHGAP11A shRNA Plasmid |
20-abx956579 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse ARHGAP11A shRNA Plasmid |
20-abx981629 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rho GTPase Activating Protein 11A (ARHGAP11A) Antibody |
20-abx014817 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Rho GTPase Activating Protein 11A (ARHGAP11A) Antibody |
20-abx307917 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rho GTPase Activating Protein 11A (ARHGAP11A) Antibody |
20-abx323890 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rho GTPase Activating Protein 11A (ARHGAP11A) Antibody |
abx331130-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
ARHGAP11A ORF Vector (Human) (pORF) |
ORF000577 |
ABM |
1.0 ug DNA |
EUR 95 |
Arhgap11a ORF Vector (Mouse) (pORF) |
ORF038920 |
ABM |
1.0 ug DNA |
EUR 506 |
Arhgap11a ORF Vector (Rat) (pORF) |
ORF063581 |
ABM |
1.0 ug DNA |
EUR 506 |
Rho GTPase Activating Protein 11A (ARHGAP11A) Antibody (HRP) |
20-abx307918 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rho GTPase Activating Protein 11A (ARHGAP11A) Antibody (FITC) |
20-abx307919 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rho GTPase Activating Protein 11A (ARHGAP11A) Antibody (Biotin) |
20-abx307920 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ARHGAP11A sgRNA CRISPR Lentivector set (Human) |
K0115201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Arhgap11a sgRNA CRISPR Lentivector set (Mouse) |
K5010001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Arhgap11a sgRNA CRISPR Lentivector set (Rat) |
K6505801 |
ABM |
3 x 1.0 ug |
EUR 339 |
ARHGAP11A sgRNA CRISPR Lentivector (Human) (Target 1) |
K0115202 |
ABM |
1.0 ug DNA |
EUR 154 |
ARHGAP11A sgRNA CRISPR Lentivector (Human) (Target 2) |
K0115203 |
ABM |
1.0 ug DNA |
EUR 154 |
ARHGAP11A sgRNA CRISPR Lentivector (Human) (Target 3) |
K0115204 |
ABM |
1.0 ug DNA |
EUR 154 |
Arhgap11a sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K5010002 |
ABM |
1.0 ug DNA |
EUR 154 |
Arhgap11a sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K5010003 |
ABM |
1.0 ug DNA |
EUR 154 |
Arhgap11a sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K5010004 |
ABM |
1.0 ug DNA |
EUR 154 |
Arhgap11a sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6505802 |
ABM |
1.0 ug DNA |
EUR 154 |
Arhgap11a sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6505803 |
ABM |
1.0 ug DNA |
EUR 154 |
Arhgap11a sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6505804 |
ABM |
1.0 ug DNA |
EUR 154 |
ARHGAP11A Protein Vector (Human) (pPB-C-His) |
PV002305 |
ABM |
500 ng |
EUR 329 |
ARHGAP11A Protein Vector (Human) (pPB-N-His) |
PV002306 |
ABM |
500 ng |
EUR 329 |
ARHGAP11A Protein Vector (Human) (pPM-C-HA) |
PV002307 |
ABM |
500 ng |
EUR 329 |
ARHGAP11A Protein Vector (Human) (pPM-C-His) |
PV002308 |
ABM |
500 ng |
EUR 329 |
ARHGAP11A Protein Vector (Mouse) (pPB-C-His) |
PV155678 |
ABM |
500 ng |
EUR 1065 |
ARHGAP11A Protein Vector (Mouse) (pPB-N-His) |
PV155679 |
ABM |
500 ng |
EUR 1065 |
ARHGAP11A Protein Vector (Mouse) (pPM-C-HA) |
PV155680 |
ABM |
500 ng |
EUR 1065 |
ARHGAP11A Protein Vector (Mouse) (pPM-C-His) |
PV155681 |
ABM |
500 ng |
EUR 1065 |
ARHGAP11A Protein Vector (Human) (pPB-His-MBP) |
PV323246 |
ABM |
500 ng |
EUR 329 |
ARHGAP11A Protein Vector (Human) (pPB-His-GST) |
PV323247 |
ABM |
500 ng |
EUR 329 |
ARHGAP11A Protein Vector (Rat) (pPB-C-His) |
PV254322 |
ABM |
500 ng |
EUR 1191 |
ARHGAP11A Protein Vector (Rat) (pPB-N-His) |
PV254323 |
ABM |
500 ng |
EUR 1191 |
ARHGAP11A Protein Vector (Rat) (pPM-C-HA) |
PV254324 |
ABM |
500 ng |
EUR 1191 |
ARHGAP11A Protein Vector (Rat) (pPM-C-His) |
PV254325 |
ABM |
500 ng |
EUR 1191 |
Arhgap11a 3'UTR Luciferase Stable Cell Line |
TU200825 |
ABM |
1.0 ml |
Ask for price |
Arhgap11a 3'UTR GFP Stable Cell Line |
TU152032 |
ABM |
1.0 ml |
Ask for price |
ARHGAP11A 3'UTR Luciferase Stable Cell Line |
TU001055 |
ABM |
1.0 ml |
EUR 1521 |
Arhgap11a 3'UTR Luciferase Stable Cell Line |
TU102032 |
ABM |
1.0 ml |
Ask for price |
ARHGAP11A 3'UTR GFP Stable Cell Line |
TU051055 |
ABM |
1.0 ml |
EUR 1521 |
Arhgap11a 3'UTR GFP Stable Cell Line |
TU250825 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |