Order Now: brent@sdlifesciences.com
 ACSS1 Polyclonal Antibody |
|
ABP57535-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthetic peptide from human protein at AA range: 620-689
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ACSS1 from Human, Mouse, Rat. This ACSS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 620-689 |
ACSS1 Polyclonal Antibody |
|
ABP57535-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthetic peptide from human protein at AA range: 620-689
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ACSS1 from Human, Mouse, Rat. This ACSS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 620-689 |
ACSS1 Polyclonal Antibody |
|
ABP57535-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic peptide from human protein at AA range: 620-689
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ACSS1 from Human, Mouse, Rat. This ACSS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 620-689 |
ACSS1 Polyclonal Antibody |
|
ES8528-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ACSS1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ACSS1 Polyclonal Antibody |
|
ES8528-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ACSS1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ACSS1 Polyclonal Antibody |
|
ES1588-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ACSS1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
ACSS1 Polyclonal Antibody |
|
ES1588-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ACSS1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
 ACSS1 Rabbit pAb |
|
A15007-100ul |
Abclonal |
100 ul |
EUR 308 |
ACSS1 Rabbit pAb |
|
A15007-200ul |
Abclonal |
200 ul |
EUR 459 |
ACSS1 Rabbit pAb |
|
A15007-20ul |
Abclonal |
20 ul |
EUR 183 |
ACSS1 Rabbit pAb |
|
A15007-50ul |
Abclonal |
50 ul |
EUR 223 |
 ACSS1 Polyclonal Conjugated Antibody |
|
C28801 |
SAB |
100ul |
EUR 397 |
 ACSS1 antibody |
|
70R-15558 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal ACSS1 antibody |
 ACSS1 Antibody |
|
1-CSB-PA000808 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against ACSS1. Recognizes ACSS1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000 |
ACSS1 Antibody |
|
1-CSB-PA001202GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against ACSS1. Recognizes ACSS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
ACSS1 Antibody |
|
1-CSB-PA925276 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
|
|
Description: A polyclonal antibody against ACSS1. Recognizes ACSS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000 |
ACSS1 Antibody |
|
DF3727 |
Affbiotech |
200ul |
EUR 304 |
|
Description: ACSS1 Antibody detects endogenous levels of total ACSS1. |
 Polyclonal Antibody) ACSS1 (Acetyl-K642) Polyclonal Antibody |
|
ABP57695-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human ACSS1 (Acetyl-K642) protein at amino acid sequence of K642
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ACSS1 Acetyl-K642) from Human, Mouse, Rat. This ACSS1 Acetyl-K642) antibody is for WB, ICC. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACSS1 (Acetyl-K642) protein at amino acid sequence of K642 |
ACSS1 (Acetyl-K642) Polyclonal Antibody |
|
ABP57695-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ACSS1 (Acetyl-K642) protein at amino acid sequence of K642
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ACSS1 Acetyl-K642) from Human, Mouse, Rat. This ACSS1 Acetyl-K642) antibody is for WB, ICC. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACSS1 (Acetyl-K642) protein at amino acid sequence of K642 |
ACSS1 (Acetyl-K642) Polyclonal Antibody |
|
ABP57695-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ACSS1 (Acetyl-K642) protein at amino acid sequence of K642
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ACSS1 Acetyl-K642) from Human, Mouse, Rat. This ACSS1 Acetyl-K642) antibody is for WB, ICC. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACSS1 (Acetyl-K642) protein at amino acid sequence of K642 |
ACSS1 (Acetyl-K642) Polyclonal Antibody |
|
HW182-100ul |
SAB |
100ul |
EUR 252 |
ACSS1 (Acetyl-K642) Polyclonal Antibody |
|
HW182-50ul |
SAB |
50ul |
EUR 187 |
ACSS1 (Acetyl-K642) Polyclonal Antibody |
|
ES8818-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ACSS1 (Acetyl-K642) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ACSS1 (Acetyl-K642) Polyclonal Antibody |
|
ES8818-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ACSS1 (Acetyl-K642) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 Anti-ACSS1 Antibody |
|
A07972 |
BosterBio |
100ul |
EUR 397 |
|
Description: Rabbit Polyclonal Antibody for ACSS1 Antibody (ACSS1) detection.tested for WB in Human, Mouse. |
 anti- ACSS1 antibody |
|
FNab00113 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:1000-1:10000
- IP: 1:200-1:2000
- Immunogen: acyl-CoA synthetase short-chain family member 1
- Uniprot ID: Q9NUB1
- Gene ID: 84532
- Research Area: Metabolism
|
|
Description: Antibody raised against ACSS1 |
 Anti-ACSS1 antibody |
|
STJ117203 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a mitochondrial acetyl-CoA synthetase enzyme. A similar protein in mice plays an important role in the tricarboxylic acid cycle by catalyzing the conversion of acetate to acetyl CoA. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. |
Anti-ACSS1 antibody |
|
STJ91458 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to ACSS1. |
Anti-ACSS1 antibody |
|
STJ98641 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to ACSS1. |
 ACSS1 siRNA |
|
20-abx906607 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ACSS1 siRNA |
|
20-abx906608 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-ACSS1 |
|
YF-PA21425 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to ACSS1 |
 Antibody) Acetyl-ACSS1 (K642) Antibody |
|
1-CSB-PA848164 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against Acetyl-ACSS1 (K642). Recognizes Acetyl-ACSS1 (K642) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000 |
 ACSS1 Blocking Peptide |
|
DF3727-BP |
Affbiotech |
1mg |
EUR 195 |
ACSS1 Blocking Peptide |
|
20-abx061084 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 ACSS1 cloning plasmid |
|
CSB-CL882105HU-10ug |
Cusabio |
10ug |
EUR 689 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2070
- Sequence: atggcggcgcgcaccctgggccgcggcgtcgggaggctgctgggcagcctgcgagggctctcggggcagcccgcgcggccgccgtgcggggtgagcgcgccgcgcagggcggcctcgggaccctcgggcagcgctcccgcagttgcagcagcagcagcacagccaggctcgtatc
- Show more
|
|
Description: A cloning plasmid for the ACSS1 gene. |
 antibody) Anti-ACSS1 (Acetyl K642) antibody |
|
STJ98836 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to E2F-1 (Acetyl-K125). |
 Mouse ACSS1 shRNA Plasmid |
|
20-abx976721 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human ACSS1 shRNA Plasmid |
|
20-abx963513 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) ACSS1 Recombinant Protein (Human) |
|
RP000343 |
ABM |
100 ug |
Ask for price |
) ACSS1 Recombinant Protein (Mouse) |
|
RP114011 |
ABM |
100 ug |
Ask for price |
) ACSS1 Recombinant Protein (Rat) |
|
RP188990 |
ABM |
100 ug |
Ask for price |
 (pORF)) Acss1 ORF Vector (Rat) (pORF) |
|
ORF062998 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) ACSS1 ORF Vector (Human) (pORF) |
|
ORF000115 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Acss1 ORF Vector (Mouse) (pORF) |
|
ORF038005 |
ABM |
1.0 ug DNA |
EUR 506 |
 ELISA kit) Rabbit Acetyl coenzyme A synthetase 2 like, mitochondrial(ACSS1) ELISA kit |
|
E04A1215-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Acetyl coenzyme A synthetase 2 like, mitochondrial(ACSS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Acetyl coenzyme A synthetase 2 like, mitochondrial(ACSS1) ELISA kit |
|
E04A1215-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Acetyl coenzyme A synthetase 2 like, mitochondrial(ACSS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Acetyl coenzyme A synthetase 2 like, mitochondrial(ACSS1) ELISA kit |
|
E04A1215-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Acetyl coenzyme A synthetase 2 like, mitochondrial(ACSS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
) Acss1 sgRNA CRISPR Lentivector set (Rat) |
|
K6701001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) ACSS1 sgRNA CRISPR Lentivector set (Human) |
|
K0033801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Acss1 sgRNA CRISPR Lentivector set (Mouse) |
|
K4013201 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Recombinant Human ACSS1, His, Yeast-100ug |
|
QP9911-ye-100ug |
EnQuireBio |
100ug |
EUR 571 |
 Recombinant Human ACSS1, His, Yeast-10ug |
|
QP9911-ye-10ug |
EnQuireBio |
10ug |
EUR 272 |
 Recombinant Human ACSS1, His, Yeast-1mg |
|
QP9911-ye-1mg |
EnQuireBio |
1mg |
EUR 2303 |
 Recombinant Human ACSS1, His, Yeast-200ug |
|
QP9911-ye-200ug |
EnQuireBio |
200ug |
EUR 898 |
 Recombinant Human ACSS1, His, Yeast-500ug |
|
QP9911-ye-500ug |
EnQuireBio |
500ug |
EUR 1505 |
 Recombinant Human ACSS1, His, Yeast-50ug |
|
QP9911-ye-50ug |
EnQuireBio |
50ug |
EUR 354 |
 (Target 1)) Acss1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6701002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Acss1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6701003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Acss1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6701004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) ACSS1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0033802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) ACSS1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0033803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) ACSS1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0033804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Acss1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4013202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Acss1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4013203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Acss1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4013204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) ACSS1 Protein Vector (Mouse) (pPB-C-His) |
|
PV152018 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) ACSS1 Protein Vector (Mouse) (pPB-N-His) |
|
PV152019 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) ACSS1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV152020 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) ACSS1 Protein Vector (Mouse) (pPM-C-His) |
|
PV152021 |
ABM |
500 ng |
EUR 1065 |
 (pPB-C-His)) ACSS1 Protein Vector (Rat) (pPB-C-His) |
|
PV251990 |
ABM |
500 ng |
EUR 1166 |
 (pPB-N-His)) ACSS1 Protein Vector (Rat) (pPB-N-His) |
|
PV251991 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-HA)) ACSS1 Protein Vector (Rat) (pPM-C-HA) |
|
PV251992 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-His)) ACSS1 Protein Vector (Rat) (pPM-C-His) |
|
PV251993 |
ABM |
500 ng |
EUR 1166 |
 (pPB-His-MBP)) ACSS1 Protein Vector (Human) (pPB-His-MBP) |
|
PV319390 |
ABM |
500 ng |
EUR 329 |
 (pPB-His-GST)) ACSS1 Protein Vector (Human) (pPB-His-GST) |
|
PV319391 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) ACSS1 Protein Vector (Human) (pPB-C-His) |
|
PV000457 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) ACSS1 Protein Vector (Human) (pPB-N-His) |
|
PV000458 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) ACSS1 Protein Vector (Human) (pPM-C-HA) |
|
PV000459 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) ACSS1 Protein Vector (Human) (pPM-C-His) |
|
PV000460 |
ABM |
500 ng |
EUR 329 |
 Acss1 3'UTR Luciferase Stable Cell Line |
|
TU101308 |
ABM |
1.0 ml |
Ask for price |
 Acss1 3'UTR GFP Stable Cell Line |
|
TU151308 |
ABM |
1.0 ml |
Ask for price |
Acss1 3'UTR Luciferase Stable Cell Line |
|
TU200203 |
ABM |
1.0 ml |
Ask for price |
Acss1 3'UTR GFP Stable Cell Line |
|
TU250203 |
ABM |
1.0 ml |
Ask for price |
 ACSS1 3'UTR GFP Stable Cell Line |
|
TU050210 |
ABM |
1.0 ml |
EUR 1521 |
 ACSS1 3'UTR Luciferase Stable Cell Line |
|
TU000210 |
ABM |
1.0 ml |
EUR 1521 |
 Antibody) Acyl-CoA Synthetase Short-Chain Family Member 1 (ACSS1) Antibody |
|
20-abx110798 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Acyl-CoA Synthetase Short-Chain Family Member 1 (ACSS1) Antibody |
|
abx038074-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Acyl-CoA Synthetase Short-Chain Family Member 1 (ACSS1) Antibody |
|
20-abx133502 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
