ACAP1 (phospho Ser554) Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

ACAP1 (phospho Ser554) Polyclonal Antibody

ABP57096-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human ACAP1 around the phosphorylation site of S554
  • Applications tips:
Description: A polyclonal antibody for detection of ACAP1 phospho Ser554) from Human. This ACAP1 phospho Ser554) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human ACAP1 around the phosphorylation site of S554

ACAP1 (phospho Ser554) Polyclonal Antibody

ABP57096-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human ACAP1 around the phosphorylation site of S554
  • Applications tips:
Description: A polyclonal antibody for detection of ACAP1 phospho Ser554) from Human. This ACAP1 phospho Ser554) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human ACAP1 around the phosphorylation site of S554

ACAP1 (phospho Ser554) Polyclonal Antibody

ABP57096-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human ACAP1 around the phosphorylation site of S554
  • Applications tips:
Description: A polyclonal antibody for detection of ACAP1 phospho Ser554) from Human. This ACAP1 phospho Ser554) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human ACAP1 around the phosphorylation site of S554

Centaurin-β1 (Phospho-Ser554) Polyclonal Conjugated Antibody

C12451 100ul
EUR 397

Centaurin-β1 (Phospho-Ser554) Antibody

12451-100ul 100ul
EUR 252

Centaurin-β1 (Phospho-Ser554) Antibody

12451-50ul 50ul
EUR 187

Anti-Phospho-DENND3 (Ser554) Antibody

P13588 100ul
EUR 398
Description: Rabbit Polyclonal Phospho-DENND3 (Ser554) Antibody. Validated in WB and tested in Human.

Phospho-ACAP1 (S554) Antibody

1-CSB-PA080059
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-ACAP1 (S554). Recognizes Phospho-ACAP1 (S554) from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

Phospho-Centaurin beta 1 (Ser554) Antibody

AF8083 200ul
EUR 376
Description: Centaurin-β1 (Phospho-Ser554) Antibody detects endogenous levels of Centaurin-β1 only when phosphorylated at Ser554.

ACAP1 Polyclonal Antibody

A64822 100 µg
EUR 570.55
Description: The best epigenetics products

Anti-Phospho-ACAP1 (S554) antibody

STJ91177 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-ACAP1 (S554).

CENTB1 antibody (Ser554)

70R-36408 100 ug
EUR 327
Description: Rabbit polyclonal CENTB1 antibody (Ser554)

ACAP1 Rabbit pAb

A15614-100ul 100 ul
EUR 308

ACAP1 Rabbit pAb

A15614-200ul 200 ul
EUR 459

ACAP1 Rabbit pAb

A15614-20ul 20 ul
EUR 183

ACAP1 Rabbit pAb

A15614-50ul 50 ul
EUR 223

Arf-GAP With Coiled-Coil, ANK Repeat And PH Domain Containing Protein 1 Phospho-Ser554 (ACAP1 pS554) Antibody

20-abx322975
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospho-Centaurin beta 1 (Ser554) Blocking Peptide

AF8083-BP 1mg
EUR 195

Anti-DENND3 (Ser554) antibody

STJ120048 100 µl
EUR 526

ACAP1 Antibody

46302-100ul 100ul
EUR 252

ACAP1 antibody

22446-100ul 100ul
EUR 390

ACAP1 antibody

70R-15531 50 ul
EUR 435
Description: Rabbit polyclonal ACAP1 antibody

ACAP1 Antibody

1-CSB-PA001131GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ACAP1. Recognizes ACAP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ACAP1 Antibody

1-CSB-PA622985EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACAP1. Recognizes ACAP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

Polyclonal ACAP1 Antibody (N-term)

APR14781G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACAP1 (N-term). This antibody is tested and proven to work in the following applications:

ACAP1 Polyclonal Antibody, HRP Conjugated

A64823 100 µg
EUR 570.55
Description: kits suitable for this type of research

ACAP1 Polyclonal Antibody, FITC Conjugated

A64824 100 µg
EUR 570.55
Description: fast delivery possible

ACAP1 Polyclonal Antibody, Biotin Conjugated

A64825 100 µg
EUR 570.55
Description: reagents widely cited

Polyclonal Goat Anti-CENTB1 / ACAP1 Antibody

APR16231G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CENTB1 / ACAP1 . This antibody is tested and proven to work in the following applications:

ACAP1 Conjugated Antibody

C46302 100ul
EUR 397

anti- ACAP1 antibody

FNab00069 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • Immunogen: ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
  • Uniprot ID: Q15027
  • Gene ID: 9744
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against ACAP1

Anti-ACAP1 antibody

PAab00069 100 ug
EUR 355

Anti-ACAP1 antibody

STJ118077 100 µl
EUR 277

ACAP1 siRNA

20-abx906467
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ACAP1 siRNA

20-abx906468
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ACAP1 Antibody, HRP conjugated

1-CSB-PA622985EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACAP1. Recognizes ACAP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ACAP1 Antibody, FITC conjugated

1-CSB-PA622985EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACAP1. Recognizes ACAP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ACAP1 Antibody, Biotin conjugated

1-CSB-PA622985ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACAP1. Recognizes ACAP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-CENTB1 / ACAP1 antibody

STJ70439 100 µg
EUR 359

ACAP1 cloning plasmid

CSB-CL622985HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2223
  • Sequence: atgacggtcaagctggatttcgaggagtgtctcaaggactcaccccgtttccgagcctctattgagctggtggaagccgaagtgtcagaattggagacccgtctggaaaagctcctgaaactgggcactggtctcctggaaagtgggcgccattaccttgctgccagccgcgcct
  • Show more
Description: A cloning plasmid for the ACAP1 gene.

pCMV-SPORT6-ACAP1

PVT14067 2 ug
EUR 391

PRC1(Phospho-Thr481)Rabbit Polyclonal Antibody

ES8619-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PRC1(Phospho-Thr481)Rabbit from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PRC1(Phospho-Thr481)Rabbit Polyclonal Antibody

ES8619-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PRC1(Phospho-Thr481)Rabbit from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ATM Phospho (Ser1981) Rabbit Polyclonal Antibody

Ab11236-050 50ul
EUR 347

ATM Phospho (Ser1981) Rabbit Polyclonal Antibody

Ab11236-100 100ul
EUR 482

Rabbit Anti-Rabbit SYN1 Polyclonal Antibody, Phospho-Ser9

CPB-795RH 100 ul
EUR 559

Rabbit Anti-Rabbit Th Polyclonal Antibody, Phospho-Ser19

CPB-840RR 100 ul
EUR 559

Rabbit Anti-Rabbit PIK3R1 Polyclonal Antibody, Phospho-Tyr467

CPB-847RH 100 ul
EUR 559

Rabbit Anti-Rabbit ERBB3 Polyclonal Antibody, Phospho-Tyr1328

CPB-848RH 100 ul
EUR 559

Rabbit Anti-Rabbit EIF4G1 Polyclonal Antibody, Phospho-Ser1232

CPB-851RH 100 ul
EUR 559

Rabbit Anti-Rabbit PRKCQ Polyclonal Antibody, Phospho-Ser695

CPB-723RH 100 ul
EUR 559

Rabbit Anti-Rabbit CTNNB1 Polyclonal Antibody, Phospho-Ser33

CPB-758RH 100 ul
EUR 559

Rabbit Anti-Rabbit CTNNB1 Polyclonal Antibody, Phospho-Ser37

CPB-759RH 100 ul
EUR 559

Histone H3(Phospho-Thr3) Rabbit Polyclonal Antibody

12083-100ul 100ul
EUR 252

Histone H3(Phospho-Ser10) Rabbit Polyclonal Antibody

12084-100ul 100ul
EUR 252

Histone H3(Phospho-Thr11) Rabbit Polyclonal Antibody

12085-100ul 100ul
EUR 252

Histone H3(Phospho-Ser28) Rabbit Polyclonal Antibody

12086-100ul 100ul
EUR 252

Histone H3(Phospho-Thr32) Rabbit Polyclonal Antibody

12087-100ul 100ul
EUR 252

Histone H3(Phospho-Tyr41) Rabbit Polyclonal Antibody

12088-100ul 100ul
EUR 252

Histone H3(Phospho-Thr45) Rabbit Polyclonal Antibody

12089-100ul 100ul
EUR 252

Histone H3(Phospho-Thr118) Rabbit Polyclonal Antibody

12090-100ul 100ul
EUR 252

Histone H4(Phospho-Ser1) Rabbit Polyclonal Antibody

12091-100ul 100ul
EUR 252

Histone H4(Phospho-Ser47) Rabbit Polyclonal Antibody

12092-100ul 100ul
EUR 252

Histone H4(Phospho-Thr80) Rabbit Polyclonal Antibody

12093-100ul 100ul
EUR 252

Histone H2B(Phospho-Ser32) Rabbit Polyclonal Antibody

12094-100ul 100ul
EUR 252

Histone H2A(Phospho-Ser129) Rabbit Polyclonal Antibody

12095-100ul 100ul
EUR 252

Histone H1(Phospho-Ser1) Rabbit Polyclonal Antibody

12096-100ul 100ul
EUR 252

Histone H1(Phospho-Thr3) Rabbit Polyclonal Antibody

12097-100ul 100ul
EUR 252

Histone H2A.X(Phospho-Thr120) Rabbit Polyclonal Antibody

12099-100ul 100ul
EUR 252

Histone H2A.X(Phospho-Ser139) Rabbit Polyclonal Antibody

12100-100ul 100ul
EUR 252

Histone H2A.X(Phospho-Tyr142) Rabbit Polyclonal Antibody

12101-100ul 100ul
EUR 252

Histone H2B(Phospho-Ser14) Rabbit Polyclonal Antibody

12102-100ul 100ul
EUR 252

Mouse ACAP1 shRNA Plasmid

20-abx981046
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Bovine ACAP1 ELISA KIT

ELI-12057b 96 Tests
EUR 928

Mouse Acap1 ELISA KIT

ELI-12058m 96 Tests
EUR 865

ACAP1 ELISA KIT|Human

EF007558 96 Tests
EUR 689

Human ACAP1 ELISA KIT

ELI-49710h 96 Tests
EUR 824

Human ACAP1 shRNA Plasmid

20-abx956511
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ACAP1 Recombinant Protein (Human)

RP000217 100 ug Ask for price

ACAP1 Recombinant Protein (Rat)

RP188777 100 ug Ask for price

ACAP1 Recombinant Protein (Mouse)

RP113684 100 ug Ask for price

Histone H3(Phospho-Thr3) Rabbit Polyclonal Polyclonal Conjugated Antibody

C12083 100ul
EUR 397

Histone H3(Phospho-Ser10) Rabbit Polyclonal Polyclonal Conjugated Antibody

C12084 100ul
EUR 397

Histone H3(Phospho-Thr11) Rabbit Polyclonal Polyclonal Conjugated Antibody

C12085 100ul
EUR 397

Histone H3(Phospho-Ser28) Rabbit Polyclonal Polyclonal Conjugated Antibody

C12086 100ul
EUR 397

Histone H4(Phospho-Ser1) Rabbit Polyclonal Polyclonal Conjugated Antibody

C12091 100ul
EUR 397

Histone H2A.X(Phospho-Tyr142) Rabbit Polyclonal Polyclonal Conjugated Antibody

C12101 100ul
EUR 397

Histone H2B(Phospho-Ser14) Rabbit Polyclonal Polyclonal Conjugated Antibody

C12102 100ul
EUR 397

Rabbit Anti-Human Histone H2A.x (phospho S139) polyclonal Rabbit Antibody

CABT-BL6118 100 ul
EUR 710

Rabbit Anti-Human INSR (Phospho Y1150)/IGF1R (Phospho Y1135) polyclonal antibody

CABT-BL115 100 ul
EUR 585

Rabbit Anti-Human Lck (Phospho Y416)/FYN (Phospho Y416) polyclonal antibody

CABT-BL118 100 ul
EUR 585

Rabbit Anti-Human STMN1 Polyclonal Antibody, Phospho-Ser38

CPB-764RH 100 ul
EUR 559

Rabbit Anti-Human Met Polyclonal Antibody, Phospho-Tyr1234

CPB-765RH 100 ul
EUR 559

Rabbit Anti-Human EGFR Polyclonal Antibody, Phospho-Tyr1197

CPB-766RH 100 ul
EUR 559

Rabbit Anti-Human EGFR Polyclonal Antibody, Phospho-Tyr869

CPB-767RH 100 ul
EUR 559

Rabbit Anti-Human IRS1 Polyclonal Antibody, Phospho-Ser636

CPB-768RH 100 ul
EUR 559

Rabbit Anti-Human IRS1 Polyclonal Antibody, Phospho-Ser639

CPB-769RH 100 ul
EUR 559

Rabbit Anti-Human RPS6 Polyclonal Antibody, Phospho-Ser235

CPB-770RH 100 ul
EUR 559

Rabbit Anti-Human STMN1 Polyclonal Antibody, Phospho-Ser16

CPB-772RH 100 ul
EUR 559

Rabbit Anti-Human MET Polyclonal Antibody, Phospho-Tyr1349

CPB-773RH 100 ul
EUR 559

Rabbit Anti-Human KIT Polyclonal Antibody, Phospho-Tyr721

CPB-774RH 100 ul
EUR 559

Rabbit Anti-Human BRCA1 Polyclonal Antibody, Phospho-Ser1423

CPB-775RH 100 ul
EUR 559

Rabbit Anti-Human CDK1 Polyclonal Antibody, Phospho-Tyr15

CPB-776RH 100 ul
EUR 559

Rabbit Anti-Human MAPK3 Polyclonal Antibody, Phospho-Tyr202

CPB-777RH 100 ul
EUR 559

Rabbit Anti-Human MAPK3 Polyclonal Antibody, Phospho-Tyr204

CPB-778RH 100 ul
EUR 559

Rabbit Anti-Human HSPB1 Polyclonal Antibody, Phospho-Ser78

CPB-779RH 100 ul
EUR 559

Rabbit Anti-Human HSPB1 Polyclonal Antibody, Phospho-Ser78

CPB-780RH 100 ul
EUR 559

Rabbit Anti-Human MAPK9 Polyclonal Antibody, Phospho- Thr183

CPB-781RH 100 ul
EUR 559

Rabbit Anti-Human NFKB1 Polyclonal Antibody, Phospho-Ser932

CPB-782RH 100 ul
EUR 559

Rabbit Anti-Human MAPK1 Polyclonal Antibody, Phospho-Thr180

CPB-783RH 100 ul
EUR 559

Rabbit Anti-Human MAPK1 Polyclonal Antibody, Phospho-ThrTyr182

CPB-784RH 100 ul
EUR 559

Rabbit Anti-Human RPS6KB1 Polyclonal Antibody, Phospho-Thr421

CPB-785RH 100 ul
EUR 559

Rabbit Anti-Human RELB Polyclonal Antibody, Phospho-Ser573

CPB-786RH 100 ul
EUR 559

Rabbit Anti-Human SNCA Polyclonal Antibody, Phospho-Tyr125

CPB-787RH 100 ul
EUR 559

Rabbit Anti-Human MAPT Polyclonal Antibody, Phospho-Thr212

CPB-788RH 100 ul
EUR 559